Performance Data

Sample Data Set
ORB scientists have performed a demonstration microRNA hybridization study in which microRNA expression was compared among 6 different human tissues. The results package is provided in .zip archive format; to download the package click on the PowerPoint slide image. Twenty two microRNAs showing significant difference among tissues based on this study were selected for validation by real-time PCR; please see Figure 4. at the bottom of this page for an overview of the results.

System Reproducibility

Fig 1. Reproducibility of Technical Replicates. Single Human Ovary and Heart RNA samples were aliquoted in duplicate to microfuge tubes then processed in parallel through Flash-tag labeling and hybridization to miRBASE version 17 ORB microarrays. Log2-transformed human probe intensities resulting from the replicate hybridizations are plotted.


Hybridization Specificity

miRNA miRNA Probe Sequence
hsa-miR-34a ACAACCAGCTAAGACACTGCCAACAACCAGCTAAGACACTGCC
hsa-miR-34a-MUT1 ACAACCAGATAAGACACTGCCAACAACCAGATAAGACACTGCCA
hsa-miR-34a-MUT2 ACAACCAGATAAGATACTGCCAACAACCAGATAAGATACTGCCA
hsa-miR-34a-SHUF GCAAGACACACGATACCTACCAGCAAGACACACGATACCTACCA

Table 1. Example of specificity control probe sequences. Specificity control probes includes a perfect match, single mismatch (MUT1), double mismatch (MUT2), and shuffled (SHUF) version of the probe.

Fig 2. Hybridization Specificity. Signal for specificity control probes complementary to three different microRNAs is shown. ORB quality control specifications require that the signal on a perfect match probe must be at least 100-fold higher than a double-mismatch (MUT2) probe.


Sensitivity

Fig 3. Detection of Spiked Ncode microRNAs. 24 attomoles of NCode spike was combined with 2.4 picomoles of LMW RNA prior to labeling for samples 1, 3, 5, 7, 9, 11, 13, 15, 17 but not for samples 2, 4, 6, 8, 10, 12, 14, 16, 18. Probes complementary to the Ncode probe showed greater than 100 fold higher signal in samples where the spike was added, as compared to samples where it was not.


Validation

Fig 4. Validation of Microarray data by Real Time qPCR. 22 microRNAs were selected from RT-qPCR validation experiment performed on six different tissue samples (Brain, Kidney, Spleen, Ovary, Heart, and Prostate). The correlation index between Microarray and RT-qPCR was generated and plotted. 21 out of 22 microRNAs showed a high correlation between Microarray and RT-qPCR.